# id: 'undetermined_barcodes' # plot_type: 'table' # section_name: ' Barcodes of Undetermined Reads' # description: "
We have determined the barcodes of your undetermined reads. Here are the top 20 barcodes. The full list is available here. If your libraries are dual indexed, the two indices are concatenated." Barcode Sequence(s) Count Frequency (%) CCCACCACAAAAGCGGAGGT 281758596 14.52 TTCTCGATGAGTGCCCGACA 264618717 13.64 GCAGTATAGGGTGCACGGAA 239555709 12.34 AACCACGCATTAACCTGAAT 216529819 11.16 ATGACGTCGCATCCTGACCT 95828631 4.94 ATGGCTTGTGCACAACATTC 83995833 4.33 ACCAGACAACCCTAGTTCCT 68452642 3.53 GTAGACGAAAACCACACTAG 65077904 3.35 CTCTAGCGAGGATGAAGATA 57718946 2.97 TACTGCAATACATGGACTCT 57578541 2.97 GAGAGGATATCCCATTTCAA 56304401 2.9 CCCGTTCTCGCCAATCCGTC 50777757 2.62 CCTTCTAGAGTCGTTGTATT 50117508 2.58 GGGGGGGGGGAGATCTCGGT 49962516 2.57 TCATCGTTCTTTCCCGAATT 43333440 2.23 CGTTCCACATTGGCTCCCTC 40431370 2.08 TCTATGAGTGTCGTTGGTTG 37035229 1.91 CCTTCTCGAGTCGTTGTATT 5317346 0.27 GGGGGGGGGGGTGCCCGACA 3979136 0.21 GGGGGGGGGGGTGCACGGAA 2268769 0.12