# id: 'undetermined_barcodes' # plot_type: 'table' # section_name: ' Barcodes of Undetermined Reads' # description: "
We have determined the barcodes of your undetermined reads (reads containing a barcode that you did not encode in your metadata). Here are the top 20 barcodes belonging to the undetermined reads. The full list is available here." Barcode Sequence(s) Count Frequency (%) ACGCGTGATCAGTAGAAACAAG 106048 1.17 ACGCGTGATCAGCAAAAGCAGG 96510 1.06 77051 0.85 CGTATGCCGTCTTCTGCTTGAA 30269 0.33 CGACGCGTGTAGCGAGATCGGA 17057 0.19 GACTATACGTCACGTGCTGTAG 14811 0.16 AGATCGGAAGAGCACACGTCTG 13628 0.15 GACTATACGTCACGTGCTGTAC 11642 0.13 > 11378 0.13 @ 11142 0.12 CGCTACACGCGTCGAGATCGGA 10469 0.12 CGGCTTTGAGGGGGCCTGACGG 10041 0.11 GTAGATCGTCTCATACGTAGCC 9027 0.1 CGAGTCGAGTGCGCGACACGAG 8798 0.1 CGTCCCTCTATTATCTCAAATC 8729 0.1 GTAGATCGTCTCATACGTAGCA 8018 0.09 GACTATACGTCACGTGCTGTAA 7798 0.09 GTAGATCGTCTCATACGTAGCG 6950 0.08 ACTAGTATGGCCCGGGGGATCC 6742 0.07 ACTGGATGCATCTGCAGGATAT 6733 0.07