# id: 'undetermined_barcodes' # plot_type: 'table' # section_name: ' Barcodes of Undetermined Reads' # description: "
We have determined the barcodes of your undetermined reads (reads containing a barcode that you did not encode in your metadata). Here are the top 20 barcodes belonging to the undetermined reads. The full list is available here. If your libraries are dual indexed, the two indicies are concatenated." Barcode Sequence(s) Count Frequency (%) GGGGGGGGGGAGATCTCGGT 49962516 27.07 GGGGGGGGGGGTGCCCGACA 3979136 2.16 GGGGGGGGGGGTGCACGGAA 2268769 1.23 GGGGGGGGGGTAACCTGAAT 2021238 1.09 CCACCACAAAAAGCGGAGGT 1895444 1.03 TTCTCGATGACCCATTTCAA 1282858 0.69 TCTCGATGAAGTGCCCGACA 1177519 0.64 CCCCCACAAAAAGCGGAGGT 1113131 0.6 CCCACACAAAAAGCGGAGGT 1079807 0.58 CCCACCACAAGGGGGGGGGG 1070709 0.58 GGGGGGGGGGATCCTGACCT 1062090 0.58 AACCACGCATCCCATTTCAA 1051609 0.57 GGGGGGGGGGCATGGACTCT 1050223 0.57 CCCACCCAAAAAGCGGAGGT 995331 0.54 GCAGTATAGGCCCATTTCAA 995325 0.54 AACCACGCATGGGGGGGGGG 975757 0.53 TTCTCGATGAGCCCGACAGT 897275 0.49 CCCACCACAACCCATTTCAA 876079 0.47 GGGGGGGGGGTCGTTGGTTG 791985 0.43 GGGGGGGGGGCCCATTTCAA 787126 0.43